After having National Geographic Genographic Project sequence my DNA, I decided to put some of this genetic sequence to music, record it, and share it, and I used a DNA section that we all have in common, so that everyone can listen to our DNA by clicking the link at the bottom of the page. The DNA genetic code is made up of four different genetic building blocks, represented by the first letter of the name of each block, adenine (A), cytosine (C), and guanine (G), and thymine (T).

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGT
ATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATA
TTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAA
ACCCCCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAAC
TGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCTACCCTTAACA
GTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCCTCTCGTC
CCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATAT
CCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGT
GAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTT
CCCCTTAAATAAGACATCACGATG

Naturally, I assigned the genetic building blocks A, C, and G the musical notes A, C, and G, but because thymine does not start with a letter that represents a musical note, I assigned thymine the letter D, to honor victims and survivers of cancer, as UV from the Sun can cause thymine "D"imers or knots in the DNA of skins cells, which in turn can cause skin cancer. Thymine does have an E at the end of the word, and an E is also a musical note, and so this is an alternative way of playing our DNA, but is harder to listen to.

This "DNA Music", "Molecular Music", and/or "Musical DNA" system will allow anyone who sequences their own DNA to play a song that is unique to them. Notes can be played as quarter notes, and repeating notes can be played as half, three-quarter, and full notes, depending on the number of DNA building blocks in a row. In the version recorded below for YouTube, our DNA is played on a classical guitar employing a classical finger picking style for each of the chords that each genetic block represents.   

Last, this DNA is from our mitochondria, organelles found in all of our cells that provide the cell the power to stay alive. Because our ears have mitochondrial DNA, you are about to listen to some of the instructions on how to power your ears, using the power of your ears.

Listen to your DNA on YOUTUBE.

Back to Home Page